“This is how you use a standard club,” I began, not grim, not sagely, but with the solicitude of one teaching a finer art than the art of death. “It’s best to give chase with the club held high,” I went on, the hologram taking place in my raised hand like what I preferred to imagine was something delicate, precious, but only slightly less ancient to the human palm—an illuminated manuscript perhaps, a lyre’s sound-chest, a feather from whose quill flowed the assorted curls of a signed peace treaty. “Once you’ve overtaken your prey, grasp the club with both hands and target the brain.” The hologram club filled and followed my gesture, glowing and pixilating. Now came the part that for them would be the good one. I imagine all my duplicate selves that have inhabited the days and weeks leading up to this moment. I imagine us all yawning in unison, inwardly; a little puff of warm carbon dioxide blown into the soul. “With the extinct Upland Moa,” I drawl with studied conviction, “some force is necessary to fully and quickly neutralize the bird. Be mindful of the animal’s size. Grasp your club firmly and swipe laterally to strike the skull from the side, as hard as you can, as if to draw blood, to draw life,” I continued, “from the Moa. Before the shillelagh,” I soothsaid, my eyes murky with cataracts and futures, “before the quarterstaff and nigh before the morning star, there was the club and she or he who wielded it. Upward and downward it swiped across the then flat earth, destroyer of daylights and phyla alike, scatterer of feathers, unlikely scepter to genocide. Our human family’s first invention,” I gasped, striking the hologram Moa, a juvenile, right where I wanted to; the bird’s cry, a speculative one created by the program, ringing out shrilly into the classroom, bright filaments of blood not drawn for an eon arcing outward, hiccupping in and out of view as the computer struggled to keep up. “Freeze,” I said loudly. I passed my hand through an unmoving trickle of red, suspended midair. I looked at the lines on my palm ruefully and turned to address my students. “Systematic, manufactured habitat loss is a far more insidious means of driving extinction than the club. The club, though, has brought its more than fair share of species down, and there is a chthonic violence, a certain queasy authenticity, in that, which rivals—bitterly—the more modern clubs seen in more recent history like, say, as Jeff Goldblum’s character in the film Jurassic Park would, ‘deforestation or the building of a dam,’ or, I’d add, the uncompleted Nicaragua Canal—an earthwork the likes of which became obsolete mid-construction for obvious reasons.” I summoned an anachron, then, to keep the students’ attention. It materialized bearded, loin-clothed, propping itself up with a pitchfork. “Now the canal is a highfalutin weapon of extinction,” it said, “no matter how effective it might be. In the old days why we would run a beast down, bash its head in and be done with it. Take the majestic Upland Moa. Entire population, whole goddamn genome, kaput. You’d see us chasinem down, I had this big club, drove a spike through it. I could bring wunna those bastards down myself,” it bragged. “Did it with this, right here. You don’t see me diggin up halfa hell knows what in Nicaragua to try and wipe out a buncha shit I ain’t even gonna eat.” The students laughed. I swiped the anachron from the room. “Can anyone tell me why canals are no longer built?” I asked the class. I selected a raised hand at random. “Because ocean,” the student answered. “Very good,” I said. “Swiping up a tract of continent to join two oceans is foolish if there aren’t two to join. Now, as we discussed at the beginning of our session, I would now like you to arrange yourselves by letter according to the sequence displayed on your EyeDis.” I watched the students line up. “In the language of DNA, you are how the gesture swipe is expressed: ATGAAGTCAACTGGATAGCC TGACATCCTGGATACTAGCC TAGAAGGTTCTCCGGCCTTAA TAAGCTTACGATTCTAAGGTTCTCTC TCTCTCGAAAGA TATAAGCTAAGGTGTGAC GTADCCCDTGAAAC. This is within you, inextricably. It has made the journey, with you, across the earth’s finicky eras and, like you, it has changed little. Like suspicion, like comeliness, like villainy, like cell division, it is here to stay.” I had more to say. “Swiping was not always the effete gesture it so widely is today, but it was always an act of dismissal. Our species has always swatted, brushed away, repelled. We perform swipe now, as ever, with abracadabran ease, without afterthought or forethought, dismissing the hologram Moa as I did before, the anachron as I did just now, dismissing them from our presence as we once dismissed the Moa and other species—dismissed them from existence, swiping them from being. The club is a tracking device for predation. It transacts changes in the hologram food chain.” I was losing them. I could see it on their eyes. I mustered as much game show host as I could, and summoned another anachron. “Did the club come first?” I asked, my zeal surging, “Or was it theft? Coming up next: a hair-raising fable about the invention of revenge.” This time the anachron is a toucan speaking in a woman’s voice. Perched in a tree in the newly materialized forest, she narrated, “Once there was a thing that walked upright.” Her voice was sunshine in paradise. A bipedal shape, more like a shadow, moseyed around the room amongst the trees and students. “The thing was morose and bright.” The shadow hung its head as a light bulb throbbed above it. “It had a friend.” Another shadow appeared and the two held hands. “One day a great wind came and the thing and the thing’s friend sought shelter under a stand of giant shefflera trees,” the toucan said as the room grew dark and looked windy and sounded windy without feeling windy. “The wind blew mightily until a great bough high in one of them splintered at the crook and came crashing down on the thing’s friend. The thing watched as the friend’s blood went away into the roots of the great tree. In retribution the thing picked up the bough and visited the same violence upon the tree, swiping at the great trunk in fury, but the branch the thing had turned into the world’s first weapon was no match. Exhausted, the thing fell asleep under the tree, still clutching the bough. When it awoke,” the toucan continued as a hologram sun rose on the room, “it left the tree, taking the bough with it. No thing had ever done that before.”

PETER MILNE GREINER is the author of *Executive Producer Chris Carter* (The
Operating System 2014). His poems, science fictions, and other writings
have appeared in *Fence*, *Motherboard*, *SciArt in America, Dark Mountain*,
*Coldfront* and elsewhere. He tumbleth, inexorably, here.